| Sequence (5’ to 3’) | \(\epsilon_{260 nm}~(M^{-1}cm^{-1})\) | DOI |
|---|---|---|
| GGGTTAGGGTTAGGGTTAGGGT | 223500 | 10.1021/ja807503g |
Structure diagram of 2KF8
Circular dichroism spectra of the 2KF8 oligonucleotide (10 µM), acquired at 25°C in 0.4-cm path-length cuvettes
\(^{1}\)H-NMR spectrum of the 2KF8 oligonucleotide, acquired at 25°C in 100 mM TMAA (pH 7.0) + 1 mM KCl
Folded fraction of the 2KF8 oligonucleotide as a function of temperature, determined by UV-melting (\(\lambda\) = 295 nm)
Native ESI-MS spectra of the 2KF8 oligonucleotide (10 µM)
Native ESI-MS spectra of the 2KF8 oligonucleotide (10 µM), focused on the 5\(^{-}\) charge state